J. B. Fenn, M. Mann, C. K. Meng, S. F. Wong, and C. M. Whitehouse, Electrospray ionization for mass spectrometry of large biomolecules, Science, vol.246, issue.4926, pp.64-71, 1989.
DOI : 10.1126/science.2675315

J. R. Marchesi, T. Sato, A. J. Weightman, T. A. Martin, J. C. Fry et al., Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA, Applied and Environmental Microbiology, vol.64, pp.795-799, 1998.

J. U. Martin, Chaperone-assisted protein folding, Current Opinion in Structural Biology, vol.7, issue.1, pp.41-52, 1997.
DOI : 10.1016/S0959-440X(97)80006-1

T. Masuzawa, T. Shimizu, Y. Yanagihara, and I. Mifuchi, Macrophage activation and immunostimulating activity of Sphaerotilus natans and its slime fraction., CHEMICAL & PHARMACEUTICAL BULLETIN, vol.35, issue.5, 1987.
DOI : 10.1248/cpb.35.2004

C. Maurines-carboneill, L. Morin, J. J. Pernelle, N. Derlet, G. Sachon et al., Reviviscence of aerobic chemoheterotrophic bacteria in an activated sludge pilot plant after a prolonged absence of oxygen, Water Research, vol.32, issue.7, pp.2211-2219, 1998.
DOI : 10.1016/S0043-1354(97)00432-6

K. Mechsner, The influence of the dissolved oxygen concentration on the physiology and ecology of Sphaerotilus natans K???tz, Oecologia, vol.28, issue.1, pp.18-20, 1983.
DOI : 10.1007/BF00379314

. Sens, ATCGGCACCGCAATCCGGT, lg : 20 ; Tm : 55.4°C ; Start, p.457

. Taille, amplicon : 1726 paires de bases ATC? Amorces sthA L2 : - FP : ATCGGCACCGCAATCCGGT, lg : 20 pb ; Tm : 58,4°C ; Start : 136 - RP : ATGCGGGTCTTGCGGATGAA, lg : 20 pb, pp.614-1693