Electrospray ionization for mass spectrometry of large biomolecules, Science, vol.246, issue.4926, pp.64-71, 1989. ,
DOI : 10.1126/science.2675315
Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16S rRNA, Applied and Environmental Microbiology, vol.64, pp.795-799, 1998. ,
Chaperone-assisted protein folding, Current Opinion in Structural Biology, vol.7, issue.1, pp.41-52, 1997. ,
DOI : 10.1016/S0959-440X(97)80006-1
Macrophage activation and immunostimulating activity of Sphaerotilus natans and its slime fraction., CHEMICAL & PHARMACEUTICAL BULLETIN, vol.35, issue.5, 1987. ,
DOI : 10.1248/cpb.35.2004
Reviviscence of aerobic chemoheterotrophic bacteria in an activated sludge pilot plant after a prolonged absence of oxygen, Water Research, vol.32, issue.7, pp.2211-2219, 1998. ,
DOI : 10.1016/S0043-1354(97)00432-6
The influence of the dissolved oxygen concentration on the physiology and ecology of Sphaerotilus natans K???tz, Oecologia, vol.28, issue.1, pp.18-20, 1983. ,
DOI : 10.1007/BF00379314
ATCGGCACCGCAATCCGGT, lg : 20 ; Tm : 55.4°C ; Start, p.457 ,
amplicon : 1726 paires de bases ATC? Amorces sthA L2 : - FP : ATCGGCACCGCAATCCGGT, lg : 20 pb ; Tm : 58,4°C ; Start : 136 - RP : ATGCGGGTCTTGCGGATGAA, lg : 20 pb, pp.614-1693 ,